TACGGCATATGCAAATGGCGAGCCTATATT 1. The DNA sequence above is being transcribed by RNA Polymerase into mRNA. What will be the resulting mRNA sequence?

TACGGCATATGCAAATGGCGAGCCTATATT
1. The DNA sequence above is being transcribed by RNA Polymerase into mRNA. What will be the resulting mRNA sequence?

Answer

• A-U-G-C-C-G-U-A-U-A-C-G-U-U-U-A-C-C-G-C-U-C-G-G-A-U-A-U-A-A – mRNA sequence
  Explanation:
  T-A-C-G-G-C-A–T-A-T-G-C-A-A-A-T-G-G-C-G-A-G-C-C-T-A-T-A-T-T
  A-U-G-C-C-G-U-A-U-A-C-G-U-U-U-A-C-C-G-C-U-C-G-G-A-U-A-U-A-A – mRNA sequence
  Adenine pairs with Uracil
  Guanine pairs with Cytosine
  Generate the complimentary strand by using the above base pairing rule, and the formed mRNA will have the sequence:
  A-U-G-C-C-G-U-A-U-A-C-G-U-U-U-A-C-C-G-C-U-C-G-G-A-U-A-U-A-A
  Note that DNA has Adenine, Thymine, Guanine, and CYtosine, while mRNA lacks THymine base, and instead has Adenine, Guanine, Cytosine and Uracil
  The process occurs in the nucleus and aided by RNA polymerase

Top of Form