You are trying to specifically amplify the region of DNA boxed below. Which of the following primer sets would be your best choice? 5′ATCGAACATTTACGGGTCGAGAGCTAGCTTATAGATACGCAGG 3′ 3′ TAGCTTGTAATGCCCAGCTCTCGATCGAATATCTATGCGTCC 5′ A. 5’AACATI 3′ 5’CGTATC 3′ B. 5’TACGGG 3? 5’TATAAG 3′ C. 5’TTACAA 3? 5’CTATGC 3° D. 5’GGGCAT 3? 5’GAATAT 3′ E. None of these primer sets would work

• Option B is the correct answer
  5′ TACGGG 3′
  5′ TATAAG 3′
  Explanation:
  One thing to note, is that replication only proceeds starting at the 3′ end of template strand, so the 5′ end of primers should bind on 3′ end of each template strand.
  Secondly, the primer usually is complimentary to the starting region of 3′ end template sequence
  Finally, base pairing remains the same; A pairs with T, G pairs with C.
  Looking to our DNA in the above case, let’s consider each strand’s sequence as highlighted, beginning on the 3′ end
  The upper strand first sequences on the 3′ end = ATATTC
  The lower strand first sequences on the 3′ end = ATGCCC
  Therefore, let us find what sequence should the primer for each of the above sequences have.
  The upper strand first sequences on the 3′ end
  3′ ATATTC….. 5′
  5′ TATAAG 3′ – The primer sequence
  The lower strand first sequences on the 3′ end
  3′ ATGCCC….. 5′
  5′ TACGGG 3′ – primer sequence

Top of Form